Review



strain designation comments source 874391  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC strain designation comments source 874391
    Strain Designation Comments Source 874391, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain designation comments source 874391/product/ATCC
    Average 90 stars, based on 6 article reviews
    strain designation comments source 874391 - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    90
    ATCC strain designation comments source 874391
    Strain Designation Comments Source 874391, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain designation comments source 874391/product/ATCC
    Average 90 stars, based on 1 article reviews
    strain designation comments source 874391 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    99
    ATCC genomic rna from human rhinovirus 17 strain 33 342
    List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.
    Genomic Rna From Human Rhinovirus 17 Strain 33 342, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic rna from human rhinovirus 17 strain 33 342/product/ATCC
    Average 99 stars, based on 1 article reviews
    genomic rna from human rhinovirus 17 strain 33 342 - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    ATCC vr 1663d
    HEV and HRV target sequences
    Vr 1663d, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vr 1663d/product/ATCC
    Average 99 stars, based on 1 article reviews
    vr 1663d - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    ATCC human rhinovirus strain 17
    HEV and HRV target sequences
    Human Rhinovirus Strain 17, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human rhinovirus strain 17/product/ATCC
    Average 99 stars, based on 1 article reviews
    human rhinovirus strain 17 - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    ATCC rhinovirus
    HEV and HRV target sequences
    Rhinovirus, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rhinovirus/product/ATCC
    Average 99 stars, based on 1 article reviews
    rhinovirus - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    ATCC ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain
    HEV and HRV target sequences
    Ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg Target Hrv F Atcc Vr 1663d Commercial Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain/product/ATCC
    Average 99 stars, based on 1 article reviews
    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    ATCC atcc vr 1663d
    HEV and HRV target sequences
    Atcc Vr 1663d, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc vr 1663d/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc vr 1663d - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    99
    atcc vr-1663d
    HEV and HRV target sequences
    Vr 1663d, supplied by atcc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vr-1663d/product/atcc
    Average 99 stars, based on 1 article reviews
    vr-1663d - by Bioz Stars, 2026-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.

    Journal: Scientific Reports

    Article Title: Commercially available SARS-CoV-2 RT-qPCR diagnostic tests need obligatory internal validation

    doi: 10.1038/s41598-023-34220-w

    Figure Lengend Snippet: List of commercially available molecular standards (nucleic acid solutions) used in analysis of the specificity of the three studied RT-qPCR assays.

    Article Snippet: Genomic RNA from Human rhinovirus 17 strain 33,342 , ATCC-VR-1663D.

    Techniques: Virus

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay

    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay